pAAV-CKIIa-stGtACR1-FusionRed
(Plasmid
#105679)
-
PurposeExpresses a soma-targeted GtACR1 in mammalian neurons under the CaMKIIa promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 105679 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
AAV5 | 105679-AAV5 | Virus (100 µL at titer ≥ 7×10¹² vg/mL) | $405 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5360
- Total vector size (bp) 7223
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsUse recA deficient growth strain to prevent homologous recombination.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namestGtACR1
-
Alt namesoma-targeted Guillardia theta anion-conducting channelrhodopsin 1
-
SpeciesSynthetic; Guillardia theta
-
Insert Size (bp)1851
- Promoter CaMKIIa
-
Tags
/ Fusion Proteins
- FusionRed (C terminal on backbone)
- Kv2.1 (C terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GATGCTGACGAAGGCTCGC
- 3′ sequencing primer CACATAGCGTAAAAGGAGCAAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Information for AAV5 (Catalog # 105679-AAV5) ( Back to top )
Addgene no longer distributes this item. Contact [email protected] for more information.
Virus (100 µL at titer ≥ 7×10¹² vg/mL)
Purpose
Ready-to-use AAV5 particles produced from pAAV-CKIIa-stGtACR1-FusionRed (#105679). In addition to the viral particles, you will also receive purified pAAV-CKIIa-stGtACR1-FusionRed plasmid DNA.
CaMKIIa-driven, soma-targeted anion-conducting channelrhodopsin fused to FusionRed for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 7×10¹² vg/mL
- Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
- Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
- Serotype AAV5
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene FusionRed
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CKIIa-stGtACR1-FusionRed was a gift from Ofer Yizhar (Addgene plasmid # 105679 ; http://n2t.net/addgene:105679 ; RRID:Addgene_105679)
For viral preps, please replace (Addgene plasmid # 105679) in the above sentence with: (Addgene viral prep # 105679-AAV5)
-
For your References section:
High-efficiency optogenetic silencing with soma-targeted anion-conducting channelrhodopsins. Mahn M, Gibor L, Patil P, Cohen-Kashi Malina K, Oring S, Printz Y, Levy R, Lampl I, Yizhar O. Nat Commun. 2018 Oct 8;9(1):4125. doi: 10.1038/s41467-018-06511-8. 10.1038/s41467-018-06511-8 PubMed 30297821