p70a-T7RNAP
(Plasmid
#105683)
-
PurposeExpresses T7 polymerase in cell-free TXTL.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 105683 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBEST-Luc
-
Backbone manufacturerPromega
- Total vector size (bp) 4486
-
Modifications to backbonepTacI promoter was removed and replaced by the bacteriophage Lambda promoter OR2-OR1-Pr, with one mutation made in this promoter. Untranslated region was removed and replaced by UTR1, a powerful UTR (see reference related to plasmid #40019) Luc gene (firefly Luciferase) was removed and replaced by T7 polymerase. A transcriptional terminator was added, called T500 (see reference related to plasmid #40019).
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)KL740
-
Growth instructionsThis plasmid should be grown at 29C, and not above 30C.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameT7 polymerase
-
Alt nameT7 RNAP
-
Insert Size (bp)2687
- Promoter OR2-OR1-Pr (bacteriophage Lambda with one mutation)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CCGCAGAGTGGATGTTTGACAT
- 3′ sequencing primer gaaggttctctgagctaccaac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Strain KL740 (CGSC, https://cgsc.biology.yale.edu/Strain.php?ID=148712)
Addgene QC NGS analysis identified a few sequence discrepancies downstream of the insert sequence, relative to the sequence provided by the depositing laboratory. It is unknown what impact this may have on plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p70a-T7RNAP was a gift from Chase Beisel (Addgene plasmid # 105683 ; http://n2t.net/addgene:105683 ; RRID:Addgene_105683) -
For your References section:
A detailed cell-free transcription-translation-based assay to decipher CRISPR protospacer-adjacent motifs. Maxwell CS, Jacobsen T, Marshall R, Noireaux V, Beisel CL. Methods. 2018 Jul 1;143:48-57. doi: 10.1016/j.ymeth.2018.02.016. Epub 2018 Feb 24. 10.1016/j.ymeth.2018.02.016 PubMed 29486239