CSM160
(Plasmid
#105684)
-
PurposePlasmid containing an RFP dropout used to construct randomized PAM library
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 105684 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneYTK001
-
Backbone manufacturerDeuber Lab
- Backbone size w/o insert (bp) 1661
- Total vector size (bp) 2567
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRFP Golden Gate dropout
-
Alt nameRFP
-
SpeciesSynthetic
-
Insert Size (bp)678
- Promoter Bba_R0040 TetR Promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGGCTTCCATGTCGGCAGAATGC
- 3′ sequencing primer TCGGGTTTCGCCACCTCTGACT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bymRFP dropout is from YTK090 from the Deuber lab MoClo kit.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Dropout flanked by BsaI sites to allow Deuber Lab MoClo 234 parts to be cloned in using Golden Gate assembly.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CSM160 was a gift from Chase Beisel (Addgene plasmid # 105684 ; http://n2t.net/addgene:105684 ; RRID:Addgene_105684) -
For your References section:
A detailed cell-free transcription-translation-based assay to decipher CRISPR protospacer-adjacent motifs. Maxwell CS, Jacobsen T, Marshall R, Noireaux V, Beisel CL. Methods. 2018 Jul 1;143:48-57. doi: 10.1016/j.ymeth.2018.02.016. Epub 2018 Feb 24. 10.1016/j.ymeth.2018.02.016 PubMed 29486239