Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CSM160
(Plasmid #105684)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 105684 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    YTK001
  • Backbone manufacturer
    Deuber Lab
  • Backbone size w/o insert (bp) 1661
  • Total vector size (bp) 2567
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RFP Golden Gate dropout
  • Alt name
    RFP
  • Species
    Synthetic
  • Insert Size (bp)
    678
  • Promoter Bba_R0040 TetR Promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGGCTTCCATGTCGGCAGAATGC
  • 3′ sequencing primer TCGGGTTTCGCCACCTCTGACT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    mRFP dropout is from YTK090 from the Deuber lab MoClo kit.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Dropout flanked by BsaI sites to allow Deuber Lab MoClo 234 parts to be cloned in using Golden Gate assembly.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CSM160 was a gift from Chase Beisel (Addgene plasmid # 105684 ; http://n2t.net/addgene:105684 ; RRID:Addgene_105684)
  • For your References section:

    A detailed cell-free transcription-translation-based assay to decipher CRISPR protospacer-adjacent motifs. Maxwell CS, Jacobsen T, Marshall R, Noireaux V, Beisel CL. Methods. 2018 Jul 1;143:48-57. doi: 10.1016/j.ymeth.2018.02.016. Epub 2018 Feb 24. 10.1016/j.ymeth.2018.02.016 PubMed 29486239