Skip to main content

pT7-7 asyn 1-106AA Mxe Histag
(Plasmid #105745)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105745 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pT7-7
  • Backbone size w/o insert (bp) 2438
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    alpha-synuclein 1-106AA Mxe Histag
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1090
  • Mutation
    1-106AA Mxe
  • Entrez Gene
    SNCA (a.k.a. NACP, PARK1, PARK4, PD1)
  • Promoter T7
  • Tag / Fusion Protein
    • His (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer T7 (TAATACGACTCACTATAGG)
  • 3′ sequencing primer AmpStop (TCAGGCAACTATGGATGAAC)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT7-7 asyn 1-106AA Mxe Histag was a gift from Hilal Lashuel (Addgene plasmid # 105745 ; http://n2t.net/addgene:105745 ; RRID:Addgene_105745)