pT7-7 asyn 1-106AA Mxe Histag
(Plasmid
#105745)
-
PurposeBacterial expression of mutant human alpha synuclein
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 105745 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepT7-7
- Backbone size w/o insert (bp) 2438
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namealpha-synuclein 1-106AA Mxe Histag
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1090
-
Mutation1-106AA Mxe
-
Entrez GeneSNCA (a.k.a. NACP, PARK1, PARK4, PD1)
- Promoter T7
-
Tag
/ Fusion Protein
- His (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer T7 (TAATACGACTCACTATAGG)
- 3′ sequencing primer AmpStop (TCAGGCAACTATGGATGAAC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT7-7 asyn 1-106AA Mxe Histag was a gift from Hilal Lashuel (Addgene plasmid # 105745 ; http://n2t.net/addgene:105745 ; RRID:Addgene_105745)