-
PurposePlasmid encoding for the translational pair that enables efficent incoporation of p-Azido-phenylalanine in response to the amber codon into proteins in mammmalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 105829 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameHumanized EAziRS
-
SpeciesSynthetic
-
Mutation(Y37L, D182S, F183M, L186A, D265R)TyrRS
- Promoter PGK
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer mPGK-F 5' cattctgcacgcttcaaaag 3'
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert name4 copies of the U6-BstYam tRNA cassette
-
SpeciesSynthetic
- Promoter U6
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer Unknown
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe humanized EAziRS gene was synthesized by Invitrogen GeneArt Gene Synthesis (Germany)/ThermoFisher Scientific (Waltham, MA).
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid has been developed for efficient incorporation of Azi into GPCRs, first used in Seidel et al. eLIFE 2017. With respect to similar plasmids from other labs, this plasmid contains a humanized gene for EAziRS and 4 copies of the U6-BstYam tRNA cassette right downstream of the synthetase cassette.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIRE4-Azi was a gift from Irene Coin (Addgene plasmid # 105829 ; http://n2t.net/addgene:105829 ; RRID:Addgene_105829) -
For your References section:
Structural insight into the activation of a class B G-protein-coupled receptor by peptide hormones in live human cells. Seidel L, Zarzycka B, Zaidi SA, Katritch V, Coin I. Elife. 2017 Aug 3;6. doi: 10.7554/eLife.27711. 10.7554/eLife.27711 PubMed 28771403