-
PurposeTo make an auxin inducible degron mutant
-
Depositing Lab
-
Depositing OrganizationThe University of Osaka
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 105985 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 105985-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 105985-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepAID1.1-N
- Backbone size w/o insert (bp) 7438
- Total vector size (bp) 7577
-
Modifications to backboneinsertion of T2A-Bsr selection marker instead of 9myc tag
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418), Blasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsE.coli growth is slow
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameT2A-Bsr
-
SpeciesSynthetic
-
Insert Size (bp)477
-
GenBank ID
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCATGGAGATCTGCCTAAAGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 105985-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 105985-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAID 1.1 N-T2A-Bsr was a gift from Tatsuo Fukagawa (Addgene plasmid # 105985 ; http://n2t.net/addgene:105985 ; RRID:Addgene_105985) -
For your References section:
An efficient method to generate conditional knockout cell lines for essential genes by combination of auxin-inducible degron tag and CRISPR/Cas9. Nishimura K, Fukagawa T. Chromosome Res. 2017 Oct;25(3-4):253-260. doi: 10.1007/s10577-017-9559-7. Epub 2017 Jun 6. 10.1007/s10577-017-9559-7 [pii] PubMed 28589221