Skip to main content

Opto-FFR3
(Plasmid #106065)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 106065 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1-
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5427
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Opto-FFR3
  • Species
    H. sapiens (human), B. taurus (bovine)
  • Insert Size (bp)
    1233
  • Mutation
    Chimeric receptor protein
  • Promoter CMV
  • Tags / Fusion Proteins
    • VSV-G (N terminal on insert)
    • Rhodopsin-1D4 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer CMV_F (CGCAAATGGGCGGTAGGCGTG)
  • 3′ sequencing primer pcDNA_R (CAACAGATGGCTGGCAAC)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

two step cloning; 5' and 3' sites cannot be used for (sub)cloning

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Opto-FFR3 was a gift from Harald Janovjak (Addgene plasmid # 106065 ; http://n2t.net/addgene:106065 ; RRID:Addgene_106065)
  • For your References section:

    Optical functionalization of human Class A orphan G-protein-coupled receptors. Morri M, Sanchez-Romero I, Tichy AM, Kainrath S, Gerrard EJ, Hirschfeld PP, Schwarz J, Janovjak H. Nat Commun. 2018 May 16;9(1):1950. doi: 10.1038/s41467-018-04342-1. 10.1038/s41467-018-04342-1 PubMed 29769519