pJL1 BSMT1
(Plasmid
#106287)
-
PurposeExpresses BSMT1 in Ecoli off a T7 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 106287 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepJL1
-
Backbone manufacturerMichael Jewett Lab
- Backbone size w/o insert (bp) 2724
- Total vector size (bp) 3264
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBSMT1
-
Alt nameSAM carboxyl methyltransferase I
-
SpeciesPetunia x hybrida
-
Insert Size (bp)1074
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAAATTAATACGACTCACTATAGGGAGACC
- 3′ sequencing primer GCTCGAGGTTATCCGGATATAGTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byIGEM part: BBa_J45004
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJL1 BSMT1 was a gift from James Collins (Addgene plasmid # 106287 ; http://n2t.net/addgene:106287 ; RRID:Addgene_106287) -
For your References section:
BioBits Explorer: A modular synthetic biology education kit. Huang A, Nguyen PQ, Stark JC, Takahashi MK, Donghia N, Ferrante T, Dy AJ, Hsu KJ, Dubner RS, Pardee K, Jewett MC, Collins JJ. Sci Adv. 2018 Aug 1;4(8):eaat5105. doi: 10.1126/sciadv.aat5105. eCollection 2018 Aug. 10.1126/sciadv.aat5105 PubMed 30083608