Skip to main content

pLenti CRISPR V2 sgShmt2_2
(Plasmid #106315)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 106315 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLENTICRISPR V2
  • Backbone size w/o insert (bp) 13000
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting mShmt2
  • gRNA/shRNA sequence
    GGAGCTTCTGCAGAGGGAGA
  • Species
    M. musculus (mouse)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti CRISPR V2 sgShmt2_2 was a gift from Richard Possemato (Addgene plasmid # 106315 ; http://n2t.net/addgene:106315 ; RRID:Addgene_106315)
  • For your References section:

    Serine Catabolism by SHMT2 Is Required for Proper Mitochondrial Translation Initiation and Maintenance of Formylmethionyl-tRNAs. Minton DR, Nam M, McLaughlin DJ, Shin J, Bayraktar EC, Alvarez SW, Sviderskiy VO, Papagiannakopoulos T, Sabatini DM, Birsoy K, Possemato R. Mol Cell. 2018 Feb 15;69(4):610-621.e5. doi: 10.1016/j.molcel.2018.01.024. 10.1016/j.molcel.2018.01.024 PubMed 29452640