Skip to main content

PX459 mDnd1#1
(Plasmid #106345)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 106345 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro (PX459)
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid # 48139)
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Dnd1
  • gRNA/shRNA sequence
    CCGTCAGGGTCCGAGGTGTA
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Dnd1 (a.k.a. RBMS4, Ter)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PX459 mDnd1#1 was a gift from Thomas Tuschl (Addgene plasmid # 106345 ; http://n2t.net/addgene:106345 ; RRID:Addgene_106345)
  • For your References section:

    DND1 maintains germline stem cells via recruitment of the CCR4-NOT complex to target mRNAs. Yamaji M, Jishage M, Meyer C, Suryawanshi H, Der E, Yamaji M, Garzia A, Morozov P, Manickavel S, McFarland HL, Roeder RG, Hafner M, Tuschl T. Nature. 2017 Mar 23;543(7646):568-572. doi: 10.1038/nature21690. Epub 2017 Mar 15. 10.1038/nature21690 PubMed 28297718