Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

SID4x-dCas9-KRAB
(Plasmid #106399)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 106399 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAC95-pmax (Addgene: 48227)
  • Backbone size w/o insert (bp) 8000
  • Total vector size (bp) 8792
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    SID4x
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    466
  • GenBank ID
    NM_002357
  • Entrez Gene
    MXD1 (a.k.a. BHLHC58, MAD, MAD1)
  • Tags / Fusion Proteins
    • HA (N terminal on insert)
    • NLS (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SgrAI (not destroyed)
  • 3′ cloning site PfiMI (not destroyed)
  • 5′ sequencing primer CAATAGAAACTGGGCTTGTCG
  • 3′ sequencing primer TCGTGCTTCTTATCCTCTTCC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    KRAB
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    225
  • GenBank ID
    NM_015394
  • Entrez Gene
    ZNF10 (a.k.a. KOX1)
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer AGAAGAGAAAGGTGGAGGCC
  • 3′ sequencing primer CGTCACCGCATGTTAGAAGG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SID4x-dCas9-KRAB was a gift from Jason Gertz (Addgene plasmid # 106399 ; http://n2t.net/addgene:106399 ; RRID:Addgene_106399)
  • For your References section:

    Multiplex Enhancer Interference Reveals Collaborative Control of Gene Regulation by Estrogen Receptor alpha-Bound Enhancers. Carleton JB, Berrett KC, Gertz J. Cell Syst. 2017 Oct 25;5(4):333-344.e5. doi: 10.1016/j.cels.2017.08.011. Epub 2017 Sep 27. 10.1016/j.cels.2017.08.011 PubMed 28964699