Skip to main content

pUNO mouse CD274 + 3'UTR WT full length
(Plasmid #107012)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107012 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUNO
  • Backbone manufacturer
    InVivoGen
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Blasticidin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CD274
  • Alt name
    PD-L1, B7-H1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3556
  • Entrez Gene
    Cd274 (a.k.a. A530045L16Rik, B7h1, Pdcd1l1, Pdcd1lg1, Pdl1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (unknown if destroyed)
  • 3′ cloning site NheI (unknown if destroyed)
  • 5′ sequencing primer n/a
  • 3′ sequencing primer EBV-RP: GTGGTTTGTCCAAACTCATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUNO mouse CD274 + 3'UTR WT full length was a gift from Julian Downward (Addgene plasmid # 107012 ; http://n2t.net/addgene:107012 ; RRID:Addgene_107012)
  • For your References section:

    Oncogenic RAS Signaling Promotes Tumor Immunoresistance by Stabilizing PD-L1 mRNA. Coelho MA, de Carne Trecesson S, Rana S, Zecchin D, Moore C, Molina-Arcas M, East P, Spencer-Dene B, Nye E, Barnouin K, Snijders AP, Lai WS, Blackshear PJ, Downward J. Immunity. 2017 Dec 19;47(6):1083-1099.e6. doi: 10.1016/j.immuni.2017.11.016. Epub 2017 Dec 12. 10.1016/j.immuni.2017.11.016 PubMed 29246442