Skip to main content

pGC680
(Plasmid #107018)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107018 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCFJ151
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP-PH
  • Species
    C. elegans (nematode)
  • Promoter lag-2
  • Tag / Fusion Protein
    • GFP

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer actggcgctactccacctttaaattgc
  • 3′ sequencing primer ttaTTTGTATAGTTCATCCATGCCATGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGC680 was a gift from Jane Hubbard (Addgene plasmid # 107018 ; http://n2t.net/addgene:107018 ; RRID:Addgene_107018)
  • For your References section:

    Linking the environment, DAF-7/TGFbeta signaling and LAG-2/DSL ligand expression in the germline stem cell niche. Pekar O, Ow MC, Hui KY, Noyes MB, Hall SE, Hubbard EJA. Development. 2017 Aug 15;144(16):2896-2906. doi: 10.1242/dev.147660. 10.1242/dev.147660 PubMed 28811311