pMAL-SsoPCNA3
(Plasmid #107069)

• Purpose: Expresses S. solfataricus PCNA3 fused to MBP in E. coli
• Depositing Lab: Teruyuki Nagamune
• Publication: Iwata et al Sci Rep. 2016 May 27;6:26588. doi: 10.1038/srep26588.

Backbone

• Vector backbone: pMAL-c5E
• Backbone manufacturer: New England Biolabs
• Backbone size w/o insert (bp): 5670
• Total vector size (bp): 6520
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Supplement with 1% glucose is recommended to suppress leaky expression.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: S. solfataricus PCNA3
• Alt name: SsoPCNA3
• Species: Synthetic; Sulfolobus solfataricus P2
• Promoter: tac promoter
• Tags / Fusion Proteins:
  • MBP (N terminal on backbone)
  • 6xHis-thrombin cleavage site (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: MBP-F
• 3′ sequencing primer: TGTCCTACTCAGGAGAGCGTTCAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry