pMAL-SsoPCNA3
(Plasmid
#107069)
-
PurposeExpresses S. solfataricus PCNA3 fused to MBP in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107069 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMAL-c5E
-
Backbone manufacturerNew England Biolabs
- Backbone size w/o insert (bp) 5670
- Total vector size (bp) 6520
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsSupplement with 1% glucose is recommended to suppress leaky expression.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameS. solfataricus PCNA3
-
Alt nameSsoPCNA3
-
SpeciesSynthetic; Sulfolobus solfataricus P2
- Promoter tac promoter
-
Tags
/ Fusion Proteins
- MBP (N terminal on backbone)
- 6xHis-thrombin cleavage site (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer MBP-F
- 3′ sequencing primer TGTCCTACTCAGGAGAGCGTTCAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMAL-SsoPCNA3 was a gift from Teruyuki Nagamune (Addgene plasmid # 107069 ; http://n2t.net/addgene:107069 ; RRID:Addgene_107069) -
For your References section:
Three proliferating cell nuclear antigen homologues from Metallosphaera sedula form a head-to-tail heterotrimer. Iwata F, Hirakawa H, Nagamune T. Sci Rep. 2016 May 27;6:26588. doi: 10.1038/srep26588. 10.1038/srep26588 PubMed 27228945