pTRE-T2-IRES-His6-Ubiquitin
(Plasmid
#107107)
-
PurposeDesigned to co-express target gene upstream of the IRES element at the multiple cloning site with downstream His6-tagged ubiquitin expressed after IRES.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107107 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTRE-T2-delta-miR-IRES
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4857
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehuman ubiquitin UBB
-
Alt nameUBB
-
SpeciesH. sapiens (human)
-
Insert Size (bp)258
-
GenBank IDGene ID: 7314
-
Entrez GeneUBB (a.k.a. HEL-S-50)
- Promoter Tet
-
Tag
/ Fusion Protein
- 6xHis (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer IRES internal sequencing primer #1: GAAGCAGTTCCTCTGGAAGC and IRES internal sequencing primer #2: GTATGGGATCTGATCTGGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
XbaI site at 3' His6 Ubiquitin is methylation sensitive
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRE-T2-IRES-His6-Ubiquitin was a gift from Michael E. Wright (Addgene plasmid # 107107 ; http://n2t.net/addgene:107107 ; RRID:Addgene_107107)