Skip to main content

pHW522 (Prab-3::cGAL-C::let-858 3'UTR)
(Plasmid #107130)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107130 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHW393
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NLS::gp41-1-C-intein::cGAL(AD)
  • Alt name
    cGAL-C
  • Promoter C. elegans rab-3 promoter

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer oHW10f, TGAGCGGATAACAATTTCAC
  • 3′ sequencing primer oHW233r, cgaattgggagacggaaagag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHW522 (Prab-3::cGAL-C::let-858 3'UTR) was a gift from Paul Sternberg (Addgene plasmid # 107130 ; http://n2t.net/addgene:107130 ; RRID:Addgene_107130)
  • For your References section:

    Split cGAL, an intersectional strategy using a split intein for refined spatiotemporal transgene control in Caenorhabditiselegans. Wang H, Liu J, Yuet KP, Hill AJ, Sternberg PW. Proc Natl Acad Sci U S A. 2018 Mar 26. pii: 1720063115. doi: 10.1073/pnas.1720063115. 10.1073/pnas.1720063115 PubMed 29581308