Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHW393 (Prab-3::GAL4-SK(DBD)::VP64::let-858 3'UTR)
(Plasmid #85583)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 85583 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pPD117.01
  • Backbone manufacturer
    Fire Lab C. elegans Vector Kit
  • Backbone size w/o insert (bp) 2778
  • Total vector size (bp) 4819
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Prab-3-GAL4-SK(DBD)-VP64
  • Insert Size (bp)
    2041
  • Promoter Prab-3-GAL4-SK(DBD)-VP64

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer oHW10f TGAGCGGATAACAATTTCAC
  • 3′ sequencing primer oHW233r cgaattgggagacggaaagag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHW393 (Prab-3::GAL4-SK(DBD)::VP64::let-858 3'UTR) was a gift from Paul Sternberg (Addgene plasmid # 85583 ; http://n2t.net/addgene:85583 ; RRID:Addgene_85583)
  • For your References section:

    cGAL, a temperature-robust GAL4-UAS system for Caenorhabditis elegans. Wang H, Liu J, Gharib S, Chai CM, Schwarz EM, Pokala N, Sternberg PW. Nat Methods. 2016 Dec 19. doi: 10.1038/nmeth.4109. 10.1038/nmeth.4109 PubMed 27992408