Flag-hPKL S113A
(Plasmid
#107160)
-
PurposeFor mammalian expression of Flag-hPKL S113A
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107160 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLHCX
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6819
- Total vector size (bp) 8477
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFlag-hPKL S113A
-
Alt namePKL
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1658
-
MutationSerine 113 mutated to alanine
-
Entrez GenePKLR (a.k.a. CNSHA2, PK1, PKL, PKRL, RPK)
- Promoter CMV
-
Tag
/ Fusion Protein
- N-term Flag
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer agctcgtttagtgaaccgtcagatc
- 3′ sequencing primer acctacaggtggggtctttcattccc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Flag-hPKL S113A was a gift from Jesse Rinehart (Addgene plasmid # 107160 ; http://n2t.net/addgene:107160 ; RRID:Addgene_107160) -
For your References section:
Distinct Hepatic PKA and CDK Signaling Pathways Control Activity-Independent Pyruvate Kinase Phosphorylation and Hepatic Glucose Production. Gassaway BM, Cardone RL, Padyana AK, Petersen MC, Judd ET, Hayes S, Tong S, Barber KW, Apostolidi M, Abulizi A, Sheetz JB, Kshitiz, Aerni HR, Gross S, Kung C, Samuel VT, Shulman GI, Kibbey RG, Rinehart J. Cell Rep. 2019 Dec 10;29(11):3394-3404.e9. doi: 10.1016/j.celrep.2019.11.009. 10.1016/j.celrep.2019.11.009 PubMed 31825824