Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLT3REVIR_MARK3 2573
(Plasmid #107233)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 107233 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLT3REVIR
  • Backbone manufacturer
    Scott Lowe
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MARK3 shRNA (22 nt)
  • gRNA/shRNA sequence
    TTAATTTACATCATAATCACTG
  • Species
    H. sapiens (human)
  • Entrez Gene
    MARK3 (a.k.a. CTAK1, KP78, PAR1A, Par-1a, VIPB)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2017/02/09/107201 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLT3REVIR_MARK3 2573 was a gift from Alex Kentsis (Addgene plasmid # 107233 ; http://n2t.net/addgene:107233 ; RRID:Addgene_107233)
  • For your References section:

    MEF2C Phosphorylation Is Required for Chemotherapy Resistance in Acute Myeloid Leukemia. Brown FC, Still E, Koche RP, Yim CY, Takao S, Cifani P, Reed C, Gunasekera S, Ficarro SB, Romanienko P, Mark W, McCarthy C, de Stanchina E, Gonen M, Seshan V, Bhola P, O'Donnell C, Spitzer B, Stutzke C, Lavallee VP, Hebert J, Krivtsov AV, Melnick A, Paietta EM, Tallman MS, Letai A, Sauvageau G, Pouliot G, Levine R, Marto JA, Armstrong SA, Kentsis A. Cancer Discov. 2018 Apr;8(4):478-497. doi: 10.1158/2159-8290.CD-17-1271. Epub 2018 Feb 5. 10.1158/2159-8290.CD-17-1271 PubMed 29431698