pSB3C5-proA-B0032-E0051
(Plasmid
#107244)
-
PurposeExpresses lacZa-GFP fusion from constitutive proA promoter
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107244 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSB3C5
-
Backbone manufacturerhttp://parts.igem.org/Part:pSB3C5
- Backbone size w/o insert (bp) 2738
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameProA-RBS(B0032)-Gemini (E0051)
-
Alt namesee partsregistry.org for more information
-
Insert Size (bp)1500
- Promoter proA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgccacctgacgtctaagaa
- 3′ sequencing primer attaccgcctttgagtgagc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSB3C5-proA-B0032-E0051 was a gift from Joseph Davis & Robert Sauer (Addgene plasmid # 107244 ; http://n2t.net/addgene:107244 ; RRID:Addgene_107244) -
For your References section:
Design, construction and characterization of a set of insulated bacterial promoters. Davis JH, Rubin AJ, Sauer RT. Nucleic Acids Res. 2011 Feb;39(3):1131-41. doi: 10.1093/nar/gkq810. Epub 2010 Sep 15. 10.1093/nar/gkq810 PubMed 20843779