Skip to main content
Addgene

BASU RaPID plasmid
(Plasmid #107250)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107250 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLEX
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BASU
  • Species
    Synthetic
  • Promoter CMV
  • Tag / Fusion Protein
    • HA

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGC AAA TGG GCG GTA GGC GTG
  • 3′ sequencing primer atatagacaaacgcacaccggcct
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The BASU protein sequence has 4 mutations relative to wild type Bacillus subtilis biotin ligase (Uniprot P0CI75): N terminal truncation of 65 aa, R124G, E323S and G325R.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BASU RaPID plasmid was a gift from Paul Khavari (Addgene plasmid # 107250 ; http://n2t.net/addgene:107250 ; RRID:Addgene_107250)
  • For your References section:

    RNA-protein interaction detection in living cells. Ramanathan M, Majzoub K, Rao DS, Neela PH, Zarnegar BJ, Mondal S, Roth JG, Gai H, Kovalski JR, Siprashvili Z, Palmer TD, Carette JE, Khavari PA. Nat Methods. 2018 Feb 5. pii: nmeth.4601. doi: 10.1038/nmeth.4601. 10.1038/nmeth.4601 PubMed 29400715