-
PurposeExpresses the BASU RaPID labeling protein
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107250 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLEX
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBASU
-
SpeciesSynthetic
- Promoter CMV
-
Tag
/ Fusion Protein
- HA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGC AAA TGG GCG GTA GGC GTG
- 3′ sequencing primer atatagacaaacgcacaccggcct
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The BASU protein sequence has 4 mutations relative to wild type Bacillus subtilis biotin ligase (Uniprot P0CI75): N terminal truncation of 65 aa, R124G, E323S and G325R.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BASU RaPID plasmid was a gift from Paul Khavari (Addgene plasmid # 107250 ; http://n2t.net/addgene:107250 ; RRID:Addgene_107250) -
For your References section:
RNA-protein interaction detection in living cells. Ramanathan M, Majzoub K, Rao DS, Neela PH, Zarnegar BJ, Mondal S, Roth JG, Gai H, Kovalski JR, Siprashvili Z, Palmer TD, Carette JE, Khavari PA. Nat Methods. 2018 Feb 5. pii: nmeth.4601. doi: 10.1038/nmeth.4601. 10.1038/nmeth.4601 PubMed 29400715