Skip to main content

pAGH51
(Plasmid #107255)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107255 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBR322
  • Backbone size w/o insert (bp) 4313
  • Total vector size (bp) 8600
  • Modifications to backbone
    used gibson cloning
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    HU-FRB
  • Alt name
    sll1712 of Synechocystis sp. PCC6803
  • Alt name
    histone-like DNA binding protein
  • Species
    Synthetic; Synecocystis sp. PCC6803
  • Insert Size (bp)
    4324
  • Promoter native HU promoter
  • Tag / Fusion Protein
    • FRB (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCTTGTGCAATGTAACATCAGAG
  • 3′ sequencing primer GTCATGATCTTCGATGTAAGTCAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAGH51 was a gift from Erin O'Shea (Addgene plasmid # 107255 ; http://n2t.net/addgene:107255 ; RRID:Addgene_107255)
  • For your References section:

    Dynamical localization of a thylakoid membrane binding protein is required for acquisition of photosynthetic competency. Gutu A, Chang F, O'Shea EK. Mol Microbiol. 2018 Jan 22. doi: 10.1111/mmi.13912. 10.1111/mmi.13912 PubMed 29357135
Commonly requested with: