Skip to main content

pMTgR2
(Plasmid #107286)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107286 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMT-BiP-V5-His
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 3646
  • Vector type
    Insect Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Interferon gamma receptor 2
  • Alt name
    IFNgR2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    660
  • Entrez Gene
    IFNGR2 (a.k.a. AF-1, IFGR2, IFNGT1, IMD28)
  • Promoter Metallothionein promoter
  • Tag / Fusion Protein
    • CATCATCACCATCACCATGA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AGATCT (not destroyed)
  • 3′ cloning site ACCGGT (not destroyed)
  • 5′ sequencing primer MT Forward, CATCTCAGTGCAACTAAA (Invitrogen)
  • 3′ sequencing primer BGH reverse: TAGAAGGCACAGTCGAGG (ThermoFisher)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Crystal structure of the extracellular part of receptor 2 of human interferon gamma; PDB ID 5eh1; doi: 10.1107/S2059798316012237

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMTgR2 was a gift from Bohdan Schneider (Addgene plasmid # 107286 ; http://n2t.net/addgene:107286 ; RRID:Addgene_107286)
  • For your References section:

    Crystal structure of human interferon-gamma receptor 2 reveals the structural basis for receptor specificity. Mikulecky P, Zahradnik J, Kolenko P, Cerny J, Charnavets T, Kolarova L, Necasova I, Pham PN, Schneider B. Acta Crystallogr D Struct Biol. 2016 Sep;72(Pt 9):1017-25. doi: 10.1107/S2059798316012237. Epub 2016 Aug 18. 10.1107/S2059798316012237 PubMed 27599734