Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #107286)


Item Catalog # Description Quantity Price (USD)
Plasmid 107286 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 3646
  • Vector type
    Insect Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Interferon gamma receptor 2
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    IFNGR2 (a.k.a. AF-1, IFGR2, IFNGT1, IMD28)
  • Promoter Metallothionein promoter
  • Tag / Fusion Protein
    • CATCATCACCATCACCATGA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AGATCT (not destroyed)
  • 3′ cloning site ACCGGT (not destroyed)
  • 5′ sequencing primer MT Forward, CATCTCAGTGCAACTAAA (Invitrogen)
  • 3′ sequencing primer BGH reverse: TAGAAGGCACAGTCGAGG (ThermoFisher)
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Crystal structure of the extracellular part of receptor 2 of human interferon gamma; PDB ID 5eh1; doi: 10.1107/S2059798316012237

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMTgR2 was a gift from Bohdan Schneider (Addgene plasmid # 107286 ; ; RRID:Addgene_107286)
  • For your References section:

    Crystal structure of human interferon-gamma receptor 2 reveals the structural basis for receptor specificity. Mikulecky P, Zahradnik J, Kolenko P, Cerny J, Charnavets T, Kolarova L, Necasova I, Pham PN, Schneider B. Acta Crystallogr D Struct Biol. 2016 Sep;72(Pt 9):1017-25. doi: 10.1107/S2059798316012237. Epub 2016 Aug 18. 10.1107/S2059798316012237 PubMed 27599734