Skip to main content

pNP1 Aqua toehold switch
(Plasmid #107356)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107356 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pNP1
  • Backbone manufacturer
    New England Biolabs (cloning vector)
  • Backbone size w/o insert (bp) 2213
  • Total vector size (bp) 3000
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    toehold switch 8 + Aquamarine
  • Insert Size (bp)
    787
  • Promoter T7

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCCGCGAAATTAATACGACTCACTATAGG
  • 3′ sequencing primer AGTGCCAAGCTTCCGGATATAGTTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    toehold - Green, A.A., Silver, P.A., Collins, J.J., and Yin, P. (2014). Toehold switches: de-novo-designed regulators of gene expression. Cell 159, 925–939. Aqua - Fabienne Merola (Addgene construct 42889)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNP1 Aqua toehold switch was a gift from James Collins (Addgene plasmid # 107356 ; http://n2t.net/addgene:107356 ; RRID:Addgene_107356)
  • For your References section:

    BioBits Explorer: A modular synthetic biology education kit. Huang A, Nguyen PQ, Stark JC, Takahashi MK, Donghia N, Ferrante T, Dy AJ, Hsu KJ, Dubner RS, Pardee K, Jewett MC, Collins JJ. Sci Adv. 2018 Aug 1;4(8):eaat5105. doi: 10.1126/sciadv.aat5105. eCollection 2018 Aug. 10.1126/sciadv.aat5105 PubMed 30083608