Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pNP1 Aqua toehold switch
(Plasmid #107356)


Item Catalog # Description Quantity Price (USD)
Plasmid 107356 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    New England Biolabs (cloning vector)
  • Backbone size w/o insert (bp) 2213
  • Total vector size (bp) 3000
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    toehold switch 8 + Aquamarine
  • Insert Size (bp)
  • Promoter T7

Cloning Information

  • Cloning method Gibson Cloning
  • 3′ sequencing primer AGTGCCAAGCTTCCGGATATAGTTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    toehold - Green, A.A., Silver, P.A., Collins, J.J., and Yin, P. (2014). Toehold switches: de-novo-designed regulators of gene expression. Cell 159, 925–939. Aqua - Fabienne Merola (Addgene construct 42889)
  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNP1 Aqua toehold switch was a gift from James Collins (Addgene plasmid # 107356 ; ; RRID:Addgene_107356)
  • For your References section:

    BioBits Explorer: A modular synthetic biology education kit. Huang A, Nguyen PQ, Stark JC, Takahashi MK, Donghia N, Ferrante T, Dy AJ, Hsu KJ, Dubner RS, Pardee K, Jewett MC, Collins JJ. Sci Adv. 2018 Aug 1;4(8):eaat5105. doi: 10.1126/sciadv.aat5105. eCollection 2018 Aug. 10.1126/sciadv.aat5105 PubMed 30083608