Skip to main content
Holiday Schedule: Addgene will be closed December 23 - December 30. Order processing and shipping will resume on January 2, 2023. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #107408)


Item Catalog # Description Quantity Price (USD)
Plasmid 107408 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 711
  • Total vector size (bp) 3124
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Use strain BL21(DE3) for expression.
  • Copy number
    High Copy


  • Gene/Insert name
  • GenBank ID
  • Promoter PthrC

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer agcttttcattctgactgca
  • 3′ sequencing primer aatttttatctgtctgtgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMB1-spect-PthrC-eGFP was a gift from Kang Zhou (Addgene plasmid # 107408 ; ; RRID:Addgene_107408)
  • For your References section:

    Short, auto-inducible promoters for well-controlled protein expression in Escherichia coli. Anilionyte, O., Liang, H., Ma, X., Yang, L., Zhou, K.. Applied Microbiology and Biotechnology, 2018 10.1007/s00253-018-9141-z