pIBA2-SpyTag-MBP
              
              
                (Plasmid
                
                #107422)
              
            
            
            
          - 
            PurposeControl construct for SpyCatcher experiments. Encodes MBP with N-terminal SpyTag, including OmpA signal peptide for periplasmic targeting.
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107422 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepASK-IBA2
 - 
              Backbone manufacturerIBA GmbH
 - Backbone size w/o insert (bp) 3286
 - Total vector size (bp) 4354
 - 
              Modifications to backbonedeletion of residues 202-276
 - 
              Vector typeBacterial Expression
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberLow Copy
 
Gene/Insert
- 
                Gene/Insert nameMaltose-binding protein (MalE)
 - 
                  Alt nameMBP
 - 
                    SpeciesE. coli
 - 
                  Insert Size (bp)1098
 - 
                    GenBank IDWP_052916395
 - Promoter Tet
 - 
    
        Tags
        / Fusion Proteins
    
- OmpA signal peptide (N terminal on backbone)
 - SpyTag (N terminal on insert)
 - StrepII (C terminal on backbone)
 
 
Cloning Information
- Cloning method Gibson Cloning
 - 5′ sequencing primer GAGTTATTTTACCACTCCCT
 - 3′ sequencing primer CGCAGTAGCGGTAAACG (Common Sequencing Primers)
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
Depositor Comments
Spycatcher was published in Zakeri et al. (2012), PNAS 109, ppE690-7
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pIBA2-SpyTag-MBP was a gift from Jack Leo (Addgene plasmid # 107422 ; http://n2t.net/addgene:107422 ; RRID:Addgene_107422) - 
                
For your References section:
Insights into the autotransport process of a trimeric autotransporter, Yersinia Adhesin A (YadA). Chauhan N, Hatlem D, Orwick-Rydmark M, Schneider K, Floetenmeyer M, van Rossum B, Leo JC, Linke D. Mol Microbiol. 2019 Jan 1. doi: 10.1111/mmi.14195. 10.1111/mmi.14195 PubMed 30600549