Skip to main content

cacnb2a (rat) in pMT2 vector
(Plasmid #107424)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107424 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMT2
  • Backbone size w/o insert (bp) 5163
  • Total vector size (bp) 7641
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    calcium channel beta2a auxillary subunit
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    2506
  • GenBank ID
    NM_053851
  • Entrez Gene
    Cacnb2 (a.k.a. Cacnlb2)
  • Promoter Ad MLP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer AGCTTGAGGTGTGGCAGGCTT
  • 3′ sequencing primer GGTCGAACCATGATGGCAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr Edward Perez-Reyes,Stritch School of Medicine, Dept of Physiology, Loyola University Chicago, Illinois, USA
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

We received it in pBluescript and subcloned it into pMT2 plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    cacnb2a (rat) in pMT2 vector was a gift from Annette Dolphin (Addgene plasmid # 107424 ; http://n2t.net/addgene:107424 ; RRID:Addgene_107424)
  • For your References section:

    The effect of overexpression of auxiliary Ca2+ channel subunits on native Ca2+ channel currents in undifferentiated mammalian NG108-15 cells. Wyatt CN, Page KM, Berrow NS, Brice NL, Dolphin AC. J Physiol. 1998 Jul 15;510 ( Pt 2):347-60. PubMed 9705988

Ready-to-use antibodies

Looking for antibodies related to this plasmid? Check out this option:

Learn More