-
PurposeExpresses Calcium channel beta2a auxillary subunit in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107424 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMT2
- Backbone size w/o insert (bp) 5163
- Total vector size (bp) 7641
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecalcium channel beta2a auxillary subunit
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)2506
-
GenBank IDNM_053851
-
Entrez GeneCacnb2 (a.k.a. Cacnlb2)
- Promoter Ad MLP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AGCTTGAGGTGTGGCAGGCTT
- 3′ sequencing primer GGTCGAACCATGATGGCAGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr Edward Perez-Reyes,Stritch School of Medicine, Dept of Physiology, Loyola University Chicago, Illinois, USA
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
We received it in pBluescript and subcloned it into pMT2 plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
cacnb2a (rat) in pMT2 vector was a gift from Annette Dolphin (Addgene plasmid # 107424 ; http://n2t.net/addgene:107424 ; RRID:Addgene_107424) -
For your References section:
The effect of overexpression of auxiliary Ca2+ channel subunits on native Ca2+ channel currents in undifferentiated mammalian NG108-15 cells. Wyatt CN, Page KM, Berrow NS, Brice NL, Dolphin AC. J Physiol. 1998 Jul 15;510 ( Pt 2):347-60. PubMed 9705988