Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

(Plasmid #107438)


Item Catalog # Description Quantity Price (USD)
Plasmid 107438 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5886
  • Vector type
    Yeast Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
  • Entrez Gene
    MET6 (a.k.a. YER091C)
  • Promoter GAL1
  • Tag / Fusion Protein
    • V5-His (C terminal on insert)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer AATATACCTCTATACTTTAACGTC
  • 3′ sequencing primer ACCGAGGAGAGGGTTAGGGAT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

contains the coding sequence for homocysteine methyltransferase

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYES2.1-cerMET6 was a gift from Clare O'Connor (Addgene plasmid # 107438 ; ; RRID:Addgene_107438)
  • For your References section:

    Pathways over Time: Functional Genomics Research in an Introductory Laboratory Course. Reeves TD, Warner DM, Ludlow LH, O'Connor CM. CBE Life Sci Educ. 2018 Spring;17(1). pii: 17/1/ar1. doi: 10.1187/cbe.17-01-0012. 10.1187/cbe.17-01-0012 PubMed 29326101