pYES2.1-pomMet26
(Plasmid
#107448)
-
PurposeOverexpression of MET fusion protein in S. cerevisiae
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107448 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepYES2.1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5886
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMet26
-
SpeciesS. pombe (fission yeast)
-
Insert Size (bp)2292
-
Entrez Genemet26 (a.k.a. SPAC9.09)
- Promoter GAL1
-
Tag
/ Fusion Protein
- V5-His (C terminal on insert)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer AATATACCTCTATACTTTAACGTC
- 3′ sequencing primer ACCGAGGAGAGGGTTAGGGAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
S. pombe Met26 gene is homologous to the S. cerevisiae MET6 gene.
pomMET26 lacks the last amino acid (A764) compared to the NCBI reference [NP_593352.1]. The plasmid has been used for complementation analyses and should function as described.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYES2.1-pomMet26 was a gift from Clare O'Connor (Addgene plasmid # 107448 ; http://n2t.net/addgene:107448 ; RRID:Addgene_107448) -
For your References section:
Pathways over Time: Functional Genomics Research in an Introductory Laboratory Course. Reeves TD, Warner DM, Ludlow LH, O'Connor CM. CBE Life Sci Educ. 2018 Spring;17(1). pii: 17/1/ar1. doi: 10.1187/cbe.17-01-0012. 10.1187/cbe.17-01-0012 PubMed 29326101