Skip to main content

pYES2.1-pomSir1
(Plasmid #107447)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107447 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pYES2.1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5886
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sir1
  • Species
    S. pombe (fission yeast)
  • Insert Size (bp)
    4419
  • Mutation
    H523R, A750T
  • Entrez Gene
    sir1 (a.k.a. SPAC10F6.01c, SPAC4C5.05c)
  • Promoter GAL1
  • Tag / Fusion Protein
    • V5-His (C terminal on insert)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer AATATACCTCTATACTTTAACGTC
  • 3′ sequencing primer ACCGAGGAGAGGGTTAGGGAT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

S. pombe Sir6 gene is homologous to the S. cerevesiae MET5 gene.

Construct was not functional in complementation analysis, but this may be due to tags rather than mutations in the coding sequence. Use with caution.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYES2.1-pomSir1 was a gift from Clare O'Connor (Addgene plasmid # 107447 ; http://n2t.net/addgene:107447 ; RRID:Addgene_107447)
  • For your References section:

    Pathways over Time: Functional Genomics Research in an Introductory Laboratory Course. Reeves TD, Warner DM, Ludlow LH, O'Connor CM. CBE Life Sci Educ. 2018 Spring;17(1). pii: 17/1/ar1. doi: 10.1187/cbe.17-01-0012. 10.1187/cbe.17-01-0012 PubMed 29326101