Skip to main content
Addgene

eMscL WT
(Plasmid #107454)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107454 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV2
  • Total vector size (bp) 6513
  • Vector type
    Mammalian Expression ; Adeno-associated viral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    bacterial mechanosensitive ion channel of large conductance
  • Alt name
    mscL
  • Species
    Escherichia Coli
  • Insert Size (bp)
    411
  • Entrez Gene
    mscL (a.k.a. b3291, ECK3277, yhdC)
  • Promoter human synapsin 1
  • Tags / Fusion Proteins
    • tdTomato fluorescence protein (C terminal on insert)
    • Kir2.1 ER export signal (FCYENEV) (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer 5’ - CTGCCTCAGTCTGCGGTGGG - 3’
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    eMscL WT was a gift from Francesco Difato (Addgene plasmid # 107454 ; http://n2t.net/addgene:107454 ; RRID:Addgene_107454)
  • For your References section:

    Mechano-sensitization of mammalian neuronal networks through expression of the bacterial mechanosensitive MscL channel. Soloperto A, Boccaccio A, Contestabile A, Moroni M, Hallinan GI, Palazzolo G, Chad J, Deinhardt K, Carugo D, Difato F. J Cell Sci. 2018 Jan 29. pii: jcs.210393. doi: 10.1242/jcs.210393. 10.1242/jcs.210393 PubMed 29361543