-
PurposeeMscL G22S is optimized for mammalian rodent neuronal expression to the plasma membrane through a neuron-specific promoter and a voltage-gated channel targeting motif
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107455 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV2
- Total vector size (bp) 6513
-
Vector typeMammalian Expression ; Adeno-associated viral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namebacterial mechanosensitive ion channel of large conductance
-
Alt namemscL
-
SpeciesEscherichia coli
-
Insert Size (bp)411
-
MutationBearing a glycine to serine substitution at position 22
-
Entrez GenemscL (a.k.a. b3291, ECK3277, yhdC)
- Promoter human synapsin 1
-
Tags
/ Fusion Proteins
- tdTomato fluorescence protein (C terminal on insert)
- Kir2.1 ER export signal (FCYENEV) (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer 5’ - CTGCCTCAGTCTGCGGTGGG - 3’ (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
eMscL G22S was a gift from Francesco Difato (Addgene plasmid # 107455 ; http://n2t.net/addgene:107455 ; RRID:Addgene_107455) -
For your References section:
Mechano-sensitization of mammalian neuronal networks through expression of the bacterial mechanosensitive MscL channel. Soloperto A, Boccaccio A, Contestabile A, Moroni M, Hallinan GI, Palazzolo G, Chad J, Deinhardt K, Carugo D, Difato F. J Cell Sci. 2018 Jan 29. pii: jcs.210393. doi: 10.1242/jcs.210393. 10.1242/jcs.210393 PubMed 29361543