Skip to main content

pTE4561
(Plasmid #107525)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107525 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clonetech
  • Backbone size w/o insert (bp) 3061
  • Total vector size (bp) 4885
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Lb crRNA
  • Alt name
    CRISPR RNA for Lachnospiraceae bacterium Cpf1 nuclease
  • Insert Size (bp)
    48
  • Promoter human U6

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    mCherry
  • Alt name
    mCherry fluorescent protein
  • Insert Size (bp)
    708
  • Promoter CBh

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer ggctgttagagagataattgg
  • 3′ sequencing primer CATTTTATGTTTCAGGTTCAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTE4561 was a gift from Ervin Welker (Addgene plasmid # 107525 ; http://n2t.net/addgene:107525 ; RRID:Addgene_107525)
  • For your References section:

    Mb- and FnCpf1 nucleases are active in mammalian cells: activities and PAM preferences of four wild-type Cpf1 nucleases and of their altered PAM specificity variants. Toth E, Czene BC, Kulcsar PI, Krausz SL, Talas A, Nyeste A, Varga E, Huszar K, Weinhardt N, Ligeti Z, Borsy AE, Fodor E, Welker E. Nucleic Acids Res. 2018 Sep 20. pii: 5103950. doi: 10.1093/nar/gky815. 10.1093/nar/gky815 PubMed 30239882