pTE3179
(Plasmid
#107528)
-
PurposeExpresses Mb crRNA and mCherry in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107528 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 3062
- Total vector size (bp) 4885
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameMb crRNA
-
Alt nameCRISPR RNA for Moraxella bovoculi Cpf1 nuclease
-
Insert Size (bp)48
- Promoter human U6
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CCTCTGACTTGAGCGTCG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCherry
-
Alt namemCherry fluorescent protein
-
Insert Size (bp)708
- Promoter CBh
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer ggctgttagagagataattgg
- 3′ sequencing primer CATTTTATGTTTCAGGTTCAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTE3179 was a gift from Ervin Welker (Addgene plasmid # 107528 ; http://n2t.net/addgene:107528 ; RRID:Addgene_107528) -
For your References section:
Mb- and FnCpf1 nucleases are active in mammalian cells: activities and PAM preferences of four wild-type Cpf1 nucleases and of their altered PAM specificity variants. Toth E, Czene BC, Kulcsar PI, Krausz SL, Talas A, Nyeste A, Varga E, Huszar K, Weinhardt N, Ligeti Z, Borsy AE, Fodor E, Welker E. Nucleic Acids Res. 2018 Sep 20. pii: 5103950. doi: 10.1093/nar/gky815. 10.1093/nar/gky815 PubMed 30239882