pTE3316
(Plasmid
#107532)
-
PurposeExpresses human codon optimized FnCpf1(RR mutant) in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107532 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5406
- Total vector size (bp) 9443
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehFnCpf1(RR)
-
Alt namehuman codon optimized Francisella novicida Cpf1 nuclease (RR mutant)
-
Insert Size (bp)4038
-
MutationN607R, K671R
- Promoter CMV
-
Tags
/ Fusion Proteins
- NLS (C terminal on insert)
- 3xHA (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTE3316 was a gift from Ervin Welker (Addgene plasmid # 107532 ; http://n2t.net/addgene:107532 ; RRID:Addgene_107532) -
For your References section:
Mb- and FnCpf1 nucleases are active in mammalian cells: activities and PAM preferences of four wild-type Cpf1 nucleases and of their altered PAM specificity variants. Toth E, Czene BC, Kulcsar PI, Krausz SL, Talas A, Nyeste A, Varga E, Huszar K, Weinhardt N, Ligeti Z, Borsy AE, Fodor E, Welker E. Nucleic Acids Res. 2018 Sep 20. pii: 5103950. doi: 10.1093/nar/gky815. 10.1093/nar/gky815 PubMed 30239882