pAAV-AICD-NLS-IRES-hrGFP
(Plasmid
#107543)
-
PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107543 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-IRES-hrGFP
-
Backbone manufacturerAgilent Technologies
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAICD-NLS
-
SpeciesH. sapiens (human)
-
MutationNone
-
Entrez GeneAPP (a.k.a. AAA, ABETA, ABPP, AD1, APPI, CTFgamma, CVAP, PN-II, PN2, alpha-sAPP, preA4)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer ATTCTGAGTCCAAGCTAGGC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Flag tag is not in frame with the insert
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-AICD-NLS-IRES-hrGFP was a gift from Hélène Marie (Addgene plasmid # 107543 ; http://n2t.net/addgene:107543 ; RRID:Addgene_107543) -
For your References section:
Physiological and pathophysiological control of synaptic GluN2B-NMDA receptors by the C-terminal domain of amyloid precursor protein. Pousinha PA, Mouska X, Raymond EF, Gwizdek C, Dhib G, Poupon G, Zaragosi LE, Giudici C, Bethus I, Pacary E, Willem M, Marie H. Elife. 2017 Jul 6;6. doi: 10.7554/eLife.25659. 10.7554/eLife.25659 PubMed 28682239