pJKW0474
(Plasmid #107588)

• Purpose: (Empty Backbone) pCLV3:Cas9
• Depositing Lab: Jing-Ke Weng
• Publication: pJKW0457 (unpublished)

Backbone

• Vector backbone: pEarleyGate100
• Backbone manufacturer: Keith Earley and Craig Pikaard
• Backbone size (bp): 11648
• Modifications to backbone: pCLV3-hSpCsn1-CLV3ter fragment was first assembled by Gibson Assembly using the following three PCR fragment: Fragment 1 CLV3 Promoter 1480bp, At genomic DNA as template F: actgatttgaaaaatctcag aattccggattatccataataa JKW1005 R: CTTATAGTCCAT ttttagagagaaagtgactgagtg JKW1006 Fragment 2 CAS9, pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene 42230) as template F: Ttctctctaaaa ATGGACTATAAGGACCACGAC JKW1007 R: Caagagattagg ttaCTTTTTCTTTTTTGCCTGG JKW1008 Fragment 3 CLV3 Terminator 1357bp, At genomic DNA as template F: AAGAAAAAGtaa cctaatctcttgttgctttaaa JKW1009 R: gccaagcttgcatgcctgca gg aattttttaaaaaaatagttaattatc JKW1010 The Gibson assembly reaction as used as template to amply this assembled fragment using primer pair JKW1105 and JKW1010. This fragment together with EcoR I and Sbf I digested pEARLEYGATE100 are used in a new Gibson assembly to make the final construct. The SbfI site can be used to clone in guide RNA fragment.
• Vector type: Plant Expression, CRISPR
• Promoter: Arabidopsis CLAVATA3

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ctactctctctgttcatttttg
• 3′ sequencing primer: GACGTTGTAAAACGACG

Resource Information

• Supplemental Documents:
  • pJKW0474.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry