pSpCAS9n(BB)-2A-puro DNM1, B
(Plasmid
#107796)
-
PurposegRNA vector for knock-in gene editing at human DNM1 locus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107796 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePX459, pSpCAS9n(BB)-2A-puro
-
Backbone manufacturerFeng Zhang (Addgene plasmid # 48139)
- Backbone size w/o insert (bp) 9200
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA targeting human DNM1
-
gRNA/shRNA sequenceGAGTAGGGGCTGAATGCGGC
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)20
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bbsl1 (unknown if destroyed)
- 3′ cloning site Bbsl1 (unknown if destroyed)
- 5′ sequencing primer U6 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Created using DNA assembly in yeast
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpCAS9n(BB)-2A-puro DNM1, B was a gift from Sandra Schmid (Addgene plasmid # 107796 ; http://n2t.net/addgene:107796 ; RRID:Addgene_107796) -
For your References section:
A noncanonical role for dynamin-1 in regulating early stages of clathrin-mediated endocytosis in non-neuronal cells. Srinivasan S, Burckhardt CJ, Bhave M, Chen Z, Chen PH, Wang X, Danuser G, Schmid SL. PLoS Biol. 2018 Apr 18;16(4):e2005377. doi: 10.1371/journal.pbio.2005377. eCollection 2018 Apr. 10.1371/journal.pbio.2005377 PubMed 29668686