p15aC-4D1D-5
(Plasmid
#107866)
-
PurposeBacterial expression of PIS, PI4K and PI4P5K
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107866 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonep15aC
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namePIS
-
Alt namephosphatidyl inositol synthase
-
Alt namephosphatidylinositol synthase
-
Alt namePI synthase
-
SpeciesTrypanosome brucei
- Promoter proD
-
Tag
/ Fusion Protein
- myc (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TATTTCTAGATTTCAGTGCA
- 3′ sequencing primer AAGATACTCTCAACCACGTAGAA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namephosphatidylinositol 4-phosphate 5-kinase
-
Alt namephosphatidylinositol 4-phosphate 5-kinase type-1 α isoform 2
-
Alt namePI4P5Kα
-
Alt namePI4P5K
-
SpeciesH. sapiens (human)
- Promoter proD (in operon)
-
Tag
/ Fusion Protein
- myc (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GCATGTATCATCTGGCGGTTCT
- 3′ sequencing primer TTACAACAGTACTGCGATGA (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namephosphatidylinositol 4-kinase β
-
Alt namePI4K
-
Alt namephosphatidyl inositol 4-kinase β
-
Alt namePI4Kβ
-
SpeciesBos taurus
- Promoter proD
-
Tag
/ Fusion Protein
- myc (N terminal on insert)
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer GAAATGCCTCAAAATGTTCTTTACGAT
- 3′ sequencing primer CTCGCCGCAGTCGAACGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byTrypanosome brucei phosphatidyl inositol synthase (PIS)(30) was kindly provided by Dr. Terry K. Smith of The University of St Andrews, UK. Human phosphatidylinositol 4-phosphate 5-kinase type-1 α isoform 2 (PI4P5Kα, PI4P5K)(51) was kindly provided by Dr. Richard A. Anderson of the University of Wisconsin - Madison. Bos taurus phosphatidylinositol 4-kinase β (PI4Kβ, PI4K)(52) was kindly provided by Dr. Tamas Balla of the Program for Developmental Neuroscience at NIH. See references in paper
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p15aC-4D1D-5 was a gift from Sanford Simon (Addgene plasmid # 107866 ; http://n2t.net/addgene:107866 ; RRID:Addgene_107866) -
For your References section:
Escherichia coli as a platform for the study of phosphoinositide biology. Botero S, Chiaroni-Clarke R, Simon SM. Sci Adv. 2019 Mar 27;5(3):eaat4872. doi: 10.1126/sciadv.aat4872. eCollection 2019 Mar. 10.1126/sciadv.aat4872 PubMed 30944849