pClodAcytCh-PIP2PHGFP
(Plasmid
#107867)
-
PurposeBacterial expression of Cherry and GFP-PLCδ-PH domain
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107867 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepClodA
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCherry and PLCδ-PH domain
-
SpeciesSynthetic
- Promoter pro D (dual)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgctgtgctctgcgaaagccagt
- 3′ sequencing primer CACCTGACGTCTAAGAAACCAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDr. Tamas Balla of the Program for Developmental Neuroscience at NIH, kindly provided the original plasmid with the PH domain of phospholipase Cδ1 (PLCδ-PH domain) which binds PIP2(42). see references in paper.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pClodAcytCh-PIP2PHGFP was a gift from Sanford Simon (Addgene plasmid # 107867 ; http://n2t.net/addgene:107867 ; RRID:Addgene_107867) -
For your References section:
Escherichia coli as a platform for the study of phosphoinositide biology. Botero S, Chiaroni-Clarke R, Simon SM. Sci Adv. 2019 Mar 27;5(3):eaat4872. doi: 10.1126/sciadv.aat4872. eCollection 2019 Mar. 10.1126/sciadv.aat4872 PubMed 30944849