Skip to main content

pClodANL-FGF2NBAA
(Plasmid #107873)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107873 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pClodANL
  • Vector type
    Bacterial Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    FGF2-minimal export
  • Alt name
    fibroblast growth factor 2
  • Alt name
    basic fibroblast growth factor 2
  • Species
    Synthetic
  • Mutation
    C77A, C95A, K128Q, R129Q, K134Q
  • Promoter pro D
  • Tag / Fusion Protein
    • NanoLuc (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCACGTCGTCCCTATCT
  • 3′ sequencing primer gatgcgctgaatcggcgtca
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pClodANL-FGF2NBAA was a gift from Sanford Simon (Addgene plasmid # 107873 ; http://n2t.net/addgene:107873 ; RRID:Addgene_107873)
  • For your References section:

    Escherichia coli as a platform for the study of phosphoinositide biology. Botero S, Chiaroni-Clarke R, Simon SM. Sci Adv. 2019 Mar 27;5(3):eaat4872. doi: 10.1126/sciadv.aat4872. eCollection 2019 Mar. 10.1126/sciadv.aat4872 PubMed 30944849