pClodANL-FGF2NBAA
(Plasmid
#107873)
-
PurposeBacterial expression of FGF2 minimum export mutant-NanoLuc
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107873 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepClodANL
-
Vector typeBacterial Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFGF2-minimal export
-
Alt namefibroblast growth factor 2
-
Alt namebasic fibroblast growth factor 2
-
SpeciesSynthetic
-
MutationC77A, C95A, K128Q, R129Q, K134Q
- Promoter pro D
-
Tag
/ Fusion Protein
- NanoLuc (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCACGTCGTCCCTATCT
- 3′ sequencing primer gatgcgctgaatcggcgtca (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pClodANL-FGF2NBAA was a gift from Sanford Simon (Addgene plasmid # 107873 ; http://n2t.net/addgene:107873 ; RRID:Addgene_107873) -
For your References section:
Escherichia coli as a platform for the study of phosphoinositide biology. Botero S, Chiaroni-Clarke R, Simon SM. Sci Adv. 2019 Mar 27;5(3):eaat4872. doi: 10.1126/sciadv.aat4872. eCollection 2019 Mar. 10.1126/sciadv.aat4872 PubMed 30944849