pWT060e
(Plasmid
#107905)
-
PurposeW2m.0-3, W2m.3-2 plasmid. Contains U6-sgRNA B (CCR5) and is part of the CAMERA2m system for cellular recording in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107905 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFYF1321
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameU6-sgRNA B (CCR5)
-
gRNA/shRNA sequenceCAGGACGGTCACCTTTGGGG
-
SpeciesH. sapiens (human), Synthetic
Cloning Information
- Cloning method Unknown
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
CloE1
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWT060e was a gift from David Liu (Addgene plasmid # 107905 ; http://n2t.net/addgene:107905 ; RRID:Addgene_107905) -
For your References section:
Rewritable multi-event analog recording in bacterial and mammalian cells. Tang W, Liu DR. Science. 2018 Feb 15. pii: science.aap8992. doi: 10.1126/science.aap8992. 10.1126/science.aap8992 PubMed 29449507