-
Purpose(Empty Backbone) Lentiviral expression plasmid of sgRNA with mCherry
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 108099 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLRG2.1
- Backbone size (bp) 9315
-
Modifications to backboneReplace GFP to mCherry
-
Vector typeMammalian Expression, Lentiviral, CRISPR
- Promoter U6 promoter for sgRNA expression and EFS promoter for mCherry expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AACTGGGAAAGTGATGTCGTGTACTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
BsmBI digestion for sgRNA cloning
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LRCherry2.1 was a gift from Christopher Vakoc (Addgene plasmid # 108099 ; http://n2t.net/addgene:108099 ; RRID:Addgene_108099) -
For your References section:
LKB1, Salt-Inducible Kinases, and MEF2C Are Linked Dependencies in Acute Myeloid Leukemia. Tarumoto Y, Lu B, Somerville TDD, Huang YH, Milazzo JP, Wu XS, Klingbeil O, El Demerdash O, Shi J, Vakoc CR. Mol Cell. 2018 Feb 28. pii: S1097-2765(18)30109-6. doi: 10.1016/j.molcel.2018.02.011. 10.1016/j.molcel.2018.02.011 PubMed 29526696