-
PurposeLentiviral expression plasmid of human SIK3 cDNA with neomycin resistance gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 108103 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLentiV_Neo
- Backbone size w/o insert (bp) 7210
- Total vector size (bp) 10989
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSIK3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3783
-
GenBank IDNM_001281749
-
Entrez GeneSIK3 (a.k.a. L19, QSK, SIK-3)
- Promoter EFS promoter
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AACTGGGAAAGTGATGTCGTGTACTG
- 3′ sequencing primer GAGAACCTGCGTGCAATCCATC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiV_Neo_SIK3 was a gift from Christopher Vakoc (Addgene plasmid # 108103 ; http://n2t.net/addgene:108103 ; RRID:Addgene_108103) -
For your References section:
LKB1, Salt-Inducible Kinases, and MEF2C Are Linked Dependencies in Acute Myeloid Leukemia. Tarumoto Y, Lu B, Somerville TDD, Huang YH, Milazzo JP, Wu XS, Klingbeil O, El Demerdash O, Shi J, Vakoc CR. Mol Cell. 2018 Feb 28. pii: S1097-2765(18)30109-6. doi: 10.1016/j.molcel.2018.02.011. 10.1016/j.molcel.2018.02.011 PubMed 29526696