pGEX2T-TEV CHMP1B 1-143
(Plasmid
#108286)
-
PurposeExpresses residues 1-143 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-278
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 108286 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEX2T-TEV
-
Backbone manufacturerAmersham
- Backbone size w/o insert (bp) 4993
- Total vector size (bp) 5404
-
Modifications to backboneTEV cleavage site added
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCHMP1B
-
Alt nameC18orf2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)423
-
Mutationamino acids 1-143
-
Entrez GeneCHMP1B (a.k.a. C10orf2, C18-ORF2, C18orf2, CHMP1.5, Vps46-2, Vps46B, hVps46-2)
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX2T-TEV CHMP1B 1-143 was a gift from Wesley Sundquist (Addgene plasmid # 108286 ; http://n2t.net/addgene:108286 ; RRID:Addgene_108286) -
For your References section:
Membrane constriction and thinning by sequential ESCRT-III polymerization. Nguyen HC, Talledge N, McCullough J, Sharma A, Moss FR 3rd, Iwasa JH, Vershinin MD, Sundquist WI, Frost A. Nat Struct Mol Biol. 2020 Apr;27(4):392-399. doi: 10.1038/s41594-020-0404-x. Epub 2020 Apr 6. 10.1038/s41594-020-0404-x PubMed 32251413