p28atDarpp
(Plasmid
#108318)
-
PurposeExpresses tDarpp in E.coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 108318 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28a
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5369
- Total vector size (bp) 5760
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)BL21(DE3)
-
Growth instructionsUse BL21(DE3) for protein expression
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nametDarpp
-
Alt nametruncated DARPP-32 isoform t-DARPP (PPP1R1B)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)525
-
GenBank IDAY070271.1
-
Entrez GenePPP1R1B (a.k.a. DARPP-32, DARPP32)
- Promoter T7
-
Tag
/ Fusion Protein
- 6 Histadine (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer gatccgccatggtgttccggctctcagagcactcc
- 3′ sequencing primer cttagactcgagtgtgccaggctcagagggggaag (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Susan Kane, City of Hope
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
L2V substitution was introduced during cloning and is not of functional concern.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p28atDarpp was a gift from Jamil Momand (Addgene plasmid # 108318 ; http://n2t.net/addgene:108318 ; RRID:Addgene_108318) -
For your References section:
t-Darpp is an elongated monomer that binds calcium and is phosphorylated by cyclin-dependent kinases 1 and 5. Momand J, Magdziarz P, Feng Y, Jiang D, Parga E, Celis A, Denny E, Wang X, Phillips ML, Monterroso E, Kane SE, Zhou F. FEBS Open Bio. 2017 Aug 29;7(9):1328-1337. doi: 10.1002/2211-5463.12269. eCollection 2017 Sep. FEB412269 [pii] PubMed 28904862