Skip to main content

p28atDarpp
(Plasmid #108318)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 108318 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28a
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5369
  • Total vector size (bp) 5760
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    BL21(DE3)
  • Growth instructions
    Use BL21(DE3) for protein expression
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    tDarpp
  • Alt name
    truncated DARPP-32 isoform t-DARPP (PPP1R1B)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    525
  • GenBank ID
    AY070271.1
  • Entrez Gene
    PPP1R1B (a.k.a. DARPP-32, DARPP32)
  • Promoter T7
  • Tag / Fusion Protein
    • 6 Histadine (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer gatccgccatggtgttccggctctcagagcactcc
  • 3′ sequencing primer cttagactcgagtgtgccaggctcagagggggaag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. Susan Kane, City of Hope

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

L2V substitution was introduced during cloning and is not of functional concern.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p28atDarpp was a gift from Jamil Momand (Addgene plasmid # 108318 ; http://n2t.net/addgene:108318 ; RRID:Addgene_108318)
  • For your References section:

    t-Darpp is an elongated monomer that binds calcium and is phosphorylated by cyclin-dependent kinases 1 and 5. Momand J, Magdziarz P, Feng Y, Jiang D, Parga E, Celis A, Denny E, Wang X, Phillips ML, Monterroso E, Kane SE, Zhou F. FEBS Open Bio. 2017 Aug 29;7(9):1328-1337. doi: 10.1002/2211-5463.12269. eCollection 2017 Sep. FEB412269 [pii] PubMed 28904862